Product name :NRF2(ARE) EMSA Kit

Catalog Number :GS-0031

Quantity :30 Reactions

Price :463 Eur

Pay now with :

Supplier :Signosis 2011

NRF2(ARE) EMSA kit is used for monitoring DNA binding activity of NRF2-related antioxidant responsive factor.

This product is intended for research use only.

 

NRF2(ARE) Probe (30ul, 20ng/ul):
5’ Biotin- TCACAGTGAGTCGGCAAAAT 3’
Store at -20oC until required
Ready to use
 
• NRF2(ARE) Cold Probe (30ul, 20ng/ul):
5’ TCACAGTGAGTCGGCAAAAT 3’
Store at -20oC until required
Ready to use
datasheet of product :NRF2(ARE) EMSA Kit NRF2(ARE) EMSA Kit

Question about this product?

Name

Email Address

Message

Retype code:

random val Reload Image


[Related Products]NRF2(ARE) EMSA Kit

Filter: (Type enter to validate)
  Cat_Number Product name Supplier Quantity Price Tech More
GS-0031 NRF2(ARE) EMSA Kit Signosis 2011 30 Reactions 463 GS-0031 NRF2(ARE) EMSA Kit Signosis 2011 30 Reactions 463€ Pub
GS-0000 EMSA Kit without Probe Signosis 2011 30 Reactions 478 GS-0000 EMSA Kit without Probe Signosis 2011 30 Reactions 478€
ASK
Pub
GS-0048 TCF LEF EMSA Kit Signosis 2011 30 Reactions 463.239 GS-0048 TCF LEF EMSA Kit Signosis 2011 30 Reactions 463.239€ Pub
GS-0054 HSF EMSA Kit: Heat shock transcription factor 1 Signosis 2011 30 Reactions 504 GS-0054 HSF EMSA Kit: Heat shock transcription factor 1 Signosis 2011 30 Reactions 504€ Pub
228-11410-1 Recombinant Mouse SCF KITLG Proteins Ray Biotech 2 147 228-11410-1 Recombinant Mouse SCF KITLG Proteins Ray Biotech 2 147€
ASK
Pub
228-11410-2 Recombinant Mouse SCF KITLG Proteins Ray Biotech 10 205 228-11410-2 Recombinant Mouse SCF KITLG Proteins Ray Biotech 10 205€
ASK
Pub
228-11410-3 Recombinant Mouse SCF KITLG Proteins Ray Biotech 1mg 2426 228-11410-3 Recombinant Mouse SCF KITLG Proteins Ray Biotech 1mg 2426€
ASK
Pub
228-11411-1 Recombinant Rat SCF KITLG Proteins Ray Biotech 2 147 228-11411-1 Recombinant Rat SCF KITLG Proteins Ray Biotech 2 147€ Pub
228-11411-2 Recombinant Rat SCF KITLG Proteins Ray Biotech 10 205 228-11411-2 Recombinant Rat SCF KITLG Proteins Ray Biotech 10 205€ Pub
228-11411-3 Recombinant Rat SCF KITLG Proteins Ray Biotech 1mg 2426 228-11411-3 Recombinant Rat SCF KITLG Proteins Ray Biotech 1mg 2426€ Pub
228-11412-1 Recombinant Human SCF KITLG Proteins Ray Biotech 2 147 228-11412-1 Recombinant Human SCF KITLG Proteins Ray Biotech 2 147€ Pub
228-11412-2 Recombinant Human SCF KITLG Proteins Ray Biotech 10 205 228-11412-2 Recombinant Human SCF KITLG Proteins Ray Biotech 10 205€ Pub
228-11412-3 Recombinant Human SCF KITLG Proteins Ray Biotech 1mg 2426 228-11412-3 Recombinant Human SCF KITLG Proteins Ray Biotech 1mg 2426€ Pub
228-11413-1 Recombinant Human SCF KITLG [from Sf9] Proteins Ray Biotech 2 147 228-11413-1 Recombinant Human SCF KITLG [from Sf9] Proteins Ray Biotech 2 147€
ASK
Pub
228-11413-2 Recombinant Human SCF KITLG [from Sf9] Proteins Ray Biotech 10 205 228-11413-2 Recombinant Human SCF KITLG [from Sf9] Proteins Ray Biotech 10 205€
ASK
Pub
228-11413-3 Recombinant Human SCF KITLG [from Sf9] Proteins Ray Biotech 1mg 0 228-11413-3 Recombinant Human SCF KITLG [from Sf9] Proteins Ray Biotech 1mg 0€
ASK
Pub
296-64401 Beta Amyloid (1 42) High Sensitivity ELISA Kit, Human Highly sensitive ELISA kit detecting beta amyloid (1 42). Detection sensitivity of the kits is about 10 times higher than that of the existing pro B-Bridge 96 tests 1201.2 296-64401 Beta Amyloid (1 42) High Sensitivity ELISA Kit, Human Highly sensitive ELISA kit detecting beta amyloid (1 42). Detection sensitivity of the kits is about 10 times higher than that of the existing pro B-Bridge 96 tests 1201.2€
ASK
Pub
50CBR101 ImmunoComb Canine Antibody Test Kits: Canine Brucella AJMAL 12tests 171 50CBR101 ImmunoComb Canine Antibody Test Kits: Canine Brucella AJMAL 12tests 171€
ASK
Pub
50CBR110 ImmunoComb Canine Antibody Test Kits: Canine Brucella AJMAL 120tests 685 50CBR110 ImmunoComb Canine Antibody Test Kits: Canine Brucella AJMAL 120tests 685€
ASK
Pub
BIO-37042 DNA kits, Column-free Isolation: SureClean Bioline 1 x 5ml 62 BIO-37042 DNA kits, Column-free Isolation: SureClean Bioline 1 x 5ml 62€
ASK
Pub
BQ007-EAEL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), Electrolytes: CO2 (405nm) Assay Kit (Enzymatic, liquid stable) Bioquant 300 tests 319 BQ007-EAEL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), Electrolytes: CO2 (405nm) Assay Kit (Enzymatic, liquid stable) Bioquant 300 tests 319€ Pub
BQ042A-EALD ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), LIVER DISEASES: Total Bile Acids (TBA) (Enzymatic Cycling) Kit Bioquant 430 tests 483 BQ042A-EALD ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), LIVER DISEASES: Total Bile Acids (TBA) (Enzymatic Cycling) Kit Bioquant 430 tests 483€ Pub
BQ062A-EACL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Calibrator (2 mL vial) Bioquant 148 BQ062A-EACL ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Calibrator (2 mL vial) Bioquant 148€
ASK
Pub
BQ062A-EACN ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Control Set (2 x 2 mL vial) Bioquant 180 BQ062A-EACN ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: NAG Control Set (2 x 2 mL vial) Bioquant 180€ Pub
BQ062A-EAKP ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: N-Acetyl-p-D-Glucosaminidase (NAG) Kit Bioquant 540 tests 448 BQ062A-EAKP ENZYMATIC ASSAY KITS (CHEMISTRY AUTOANALYZER), KIDNEY AND PANCREATIC DISEASES: N-Acetyl-p-D-Glucosaminidase (NAG) Kit Bioquant 540 tests 448€ Pub
CQBL-05K CellQuanti Blue™ Cell Viability Assay Kits Bioassays 5000 170.887 CQBL-05K CellQuanti Blue™ Cell Viability Assay Kits Bioassays 5000 170.887€ Pub
CQBL-10K CellQuanti-Blue™ Cell Viability Assay Kits Bioassays 10000 tests 229 CQBL-10K CellQuanti-Blue™ Cell Viability Assay Kits Bioassays 10000 tests 229€ Pub
CQBL-10K CellQuanti Blue™ Cell Viability Assay Kits Bioassays 10000 283.185 CQBL-10K CellQuanti Blue™ Cell Viability Assay Kits Bioassays 10000 283.185€ Pub
CQMT-01K CellQuanti-MTT™ Cell Viability Assay Kits Bioassays 1000 tests 173 CQMT-01K CellQuanti-MTT™ Cell Viability Assay Kits Bioassays 1000 tests 173€ Pub
CQMT-01K CellQuanti MTT™ Cell Viability Assay Kits Bioassays 1000 230.454 CQMT-01K CellQuanti MTT™ Cell Viability Assay Kits Bioassays 1000 230.454€ Pub
CQMT-500 CellQuanti-MTT™ Cell Viability Assay Kits Bioassays 500 tests 133 CQMT-500 CellQuanti-MTT™ Cell Viability Assay Kits Bioassays 500 tests 133€ Pub
CQMT-500 CellQuanti MTT™ Cell Viability Assay Kits Bioassays 500 174.794 CQMT-500 CellQuanti MTT™ Cell Viability Assay Kits Bioassays 500 174.794€ Pub
DI0207 KITLG & FLT3LG Protein Protein Interaction Antibody Pair Abnova 1 Set 765 DI0207 KITLG & FLT3LG Protein Protein Interaction Antibody Pair Abnova 1 Set 765€
ASK
Pub
K-3030-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ Plasmid Extraction kit Bioneer 96-well plate X 2 290 K-3030-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ Plasmid Extraction kit Bioneer 96-well plate X 2 290€ Pub
K-3032-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ Genomic DNA Extraction kit Bioneer 96-well plate X 2 0 K-3032-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ Genomic DNA Extraction kit Bioneer 96-well plate X 2 0€ Pub
K-3034-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ PCR Purification kit Bioneer 96-well plate X 2 305 K-3034-2 Kits for 96 well Plate Vacuum Manifold AccuPrep™ PCR Purification kit Bioneer 96-well plate X 2 305€
ASK
Pub
K128-100 Annexin V PE Apoptosis Detection Kit100 assays Biovision 100 assays 315 K128-100 Annexin V PE Apoptosis Detection Kit100 assays Biovision 100 assays 315€
ASK
Pub
K256-100 Mitochondria Cytosol Fractionation Kit100 assays Biovision 100 assays 314.685 K256-100 Mitochondria Cytosol Fractionation Kit100 assays Biovision 100 assays 314.685€
ASK
Pub
K256-25 Mitochondria Cytosol Fractionation Kit25 assays Biovision 25 assays 164.43 K256-25 Mitochondria Cytosol Fractionation Kit25 assays Biovision 25 assays 164.43€
ASK
Pub
K264-100 Glutathione (GSH GSSG Total) Assay Kit100 assays Biovision 100 assays 409.185 K264-100 Glutathione (GSH GSSG Total) Assay Kit100 assays Biovision 100 assays 409.185€ Pub
K265-200 Hydrogen Peroxide Assay Kit200 assays Biovision 200 assays 230.58 K265-200 Hydrogen Peroxide Assay Kit200 assays Biovision 200 assays 230.58€ Pub
K266-100 Nuclear Cytosol Fractionation Kit100 assays Biovision 100 assays 314.685 K266-100 Nuclear Cytosol Fractionation Kit100 assays Biovision 100 assays 314.685€
ASK
Pub
K266-25 Nuclear Cytosol Fractionation Kit25 assays Biovision 25 assays 164.43 K266-25 Nuclear Cytosol Fractionation Kit25 assays Biovision 25 assays 164.43€
ASK
Pub
K267-50 Cytosol Particulate Separation Kit50 assays Biovision 50 assays 276.885 K267-50 Cytosol Particulate Separation Kit50 assays Biovision 50 assays 276.885€ Pub
K268-50 Membrane Protein Extraction Kit50 assays Biovision 50 assays 314.685 K268-50 Membrane Protein Extraction Kit50 assays Biovision 50 assays 314.685€ Pub
K269-500 Mammalian Cell Extraction Kit500 assays Biovision 500 assays 221.13 K269-500 Mammalian Cell Extraction Kit500 assays Biovision 500 assays 221.13€ Pub
K270-50 FractionPREP Cell Fractionation Kit50 assays Biovision 50 assays 400.68 K270-50 FractionPREP Cell Fractionation Kit50 assays Biovision 50 assays 400.68€ Pub
K274-100 Total Antioxidant Capacity (TAC) Assay Kit100 assays Biovision 100 assays 325.08 K274-100 Total Antioxidant Capacity (TAC) Assay Kit100 assays Biovision 100 assays 325.08€ Pub
K280-50 Mitochondrial DNA Isolation Kit50 assays Biovision 50 assays 390.285 K280-50 Mitochondrial DNA Isolation Kit50 assays Biovision 50 assays 390.285€ Pub
K403-50 ApoBrdU IHC DNA Fragmentation Assay Kit50 assays Biovision 50 assays 579 K403-50 ApoBrdU IHC DNA Fragmentation Assay Kit50 assays Biovision 50 assays 579€
ASK
Pub
K410-500 Phosphate Colorimetric Assay Kit500 assays Biovision 500 assays 0 K410-500 Phosphate Colorimetric Assay Kit500 assays Biovision 500 assays 0€ Pub
K661-100 Ascorbic Acid Assay Kit100 assays Biovision 100 assays 325.08 K661-100 Ascorbic Acid Assay Kit100 assays Biovision 100 assays 325.08€ Pub
K761-200 Glutathione Reductase Assay Kit200 assays Biovision 200 assays 325.08 K761-200 Glutathione Reductase Assay Kit200 assays Biovision 200 assays 325.08€ Pub
K773-100 Catalase Assay Kit100 assays Biovision 100 assays 230.58 K773-100 Catalase Assay Kit100 assays Biovision 100 assays 230.58€ Pub
K808-200 Deproteinizing Sample Preparation Kit200 assays Biovision 200 assays 231 K808-200 Deproteinizing Sample Preparation Kit200 assays Biovision 200 assays 231€ Pub
MD-14-0252P Recombinant Human SCF KITLG Proteins Ray Biotech 10 309 MD-14-0252P Recombinant Human SCF KITLG Proteins Ray Biotech 10 309€
ASK
Pub
MD-14-0253P Recombinant Mouse SCF KITLG Proteins Ray Biotech 10 309 MD-14-0253P Recombinant Mouse SCF KITLG Proteins Ray Biotech 10 309€
ASK
Pub
MD-14-0255P Recombinant Human SDF-1a KITLG Proteins Ray Biotech 10 309 MD-14-0255P Recombinant Human SDF-1a KITLG Proteins Ray Biotech 10 309€
ASK
Pub
PBKXL-10 ProPrep™ Genomic XL-10 High-Throughput Genomic DNA Isolation Kits Biotech support group 10, 10ml whole blood 655 PBKXL-10 ProPrep™ Genomic XL-10 High-Throughput Genomic DNA Isolation Kits Biotech support group 10, 10ml whole blood 655€ Pub
PLF-960 ProPrep™ BAC 960 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group 10x96, 2.0ml cultures 1501 PLF-960 ProPrep™ BAC 960 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group 10x96, 2.0ml cultures 1501€ Pub
PPO-200 ProPrep™ Omni 200 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group Up to 200 ml cultures 460 PPO-200 ProPrep™ Omni 200 High-Throughput BAC & Plasmid DNA Isolation Kits Biotech support group Up to 200 ml cultures 460€ Pub
SL100489-CaS Transfection Reagents and Kits, GenJet™ DNA In Vitro Tranfection Reagent for Ca Ski was pre optimized for most efficiently transfecting Ca Ski cells. Signagen 1 ml 231.368 SL100489-CaS Transfection Reagents and Kits, GenJet™ DNA In Vitro Tranfection Reagent for Ca Ski was pre optimized for most efficiently transfecting Ca Ski cells. Signagen 1 ml 231.368€ Pub
  Cat_Number Product name Supplier Quantity Price PDF Pub