Only in Titles

Search results for: Taq DNA Polymerase

paperclip

#33616434   2021/02/22 To Up

First report of root rot and damping off disease in soybean caused by in India.

Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen's identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as mentioned by White et al. (1990). Amplification was performed in a 12.5 μL reaction volume containing 1.5 μL of 10X PCR buffer, 3 μL of 25 mM MgCl2, 1.2 μL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 μL of 10 pM each primer (ITS 1 and ITS 4), and 1 μL of DNA template, 0.3 μL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5'GCTGGCCTTGATGTTGTTCG3') and BtR (5'CGTGA AGAGTACCCAGAC CG3'). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5'GGTGCTTTTTCAGGTGTAGTTGG3') and COXR (5'GCTCCTGCTAATACTGGTAATG T3'). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.
Sanjeev Kumar, Laxman Singh Rajput, Rajkumar Haribhau Ramteke, Nataraj Venampally, Milind Ratnaparkhe, Hemant Singh Maheshwari, Shivakumar Maranna

2164 related Products with: First report of root rot and damping off disease in soybean caused by in India.

96 tests 50 UG96 tests25mg1-99 mg/ml/ea price x 2500 tests

Related Pathways

paperclip

#33520948   2021/01/14 To Up

A Single Amino Acid Change to Taq DNA Polymerase Enables Faster PCR, Reverse Transcription and Strand-Displacement.

A change of an aspartic acid to asparagine of Taq () DNA polymerase is a gain of function mutation that supports faster PCR: the extension times for PCR amplification can be 2-3 times shorter. Surprising results from negative controls led to the discovery of strand-displacement ability and reverse transcriptase activity of Taq D732N DNA polymerase. We demonstrate that the mutant enzyme can, by itself, catalyze RT-PCR, and RT-LAMP assays. Residue 732 is on the surface of the enzyme, not near the active site.
Wayne M Barnes, Zhian Zhang, Milko B Kermekchiev

1533 related Products with: A Single Amino Acid Change to Taq DNA Polymerase Enables Faster PCR, Reverse Transcription and Strand-Displacement.

10 500 mg1 mg2 g250 mg10 mg 500 G100 mg25 mg10 mg25 mg5 mg

Related Pathways

paperclip

#33510377   2021/01/28 To Up

Mononucleotide repeat expansions with non-natural polymerase substrates.

Replicative strand slippage is a biological phenomenon, ubiquitous among different organisms. However, slippage events are also relevant to non-natural replication models utilizing synthetic polymerase substrates. Strand slippage may notably affect the outcome of the primer extension reaction with repetitive templates in the presence of non-natural nucleoside triphosphates. In the current paper, we studied the ability of Taq, Vent (exo-), and Deep Vent (exo-) polymerases to produce truncated, full size, or expanded modified strands utilizing non-natural 2'-deoxyuridine nucleotide analogues and different variants of the homopolymer template. Our data suggest that the slippage of the primer strand is dependent on the duplex fluttering, incorporation efficiency for a particular polymerase-dNTP pair, rate of non-templated base addition, and presence of competing nucleotides.
Alexander V Chudinov, Vadim A Vasiliskov, Viktoriya E Kuznetsova, Sergey A Lapa, Natalia A Kolganova, Edward N Timofeev

1067 related Products with: Mononucleotide repeat expansions with non-natural polymerase substrates.

100ug Lyophilized1000 Units250ul250 Units100ug Lyophilized250 Units100ug Lyophilized500 Units250 Units100ug Lyophilized250 Units

Related Pathways

paperclip

#33453957   // To Up

Building better polymerases: Engineering the replication of expanded genetic alphabets.

DNA polymerases are today used throughout scientific research, biotechnology, and medicine, in part for their ability to interact with unnatural forms of DNA created by synthetic biologists. Here especially, natural DNA polymerases often do not have the "performance specifications" needed for transformative technologies. This creates a need for science-guided rational (or semi-rational) engineering to identify variants that replicate unnatural base pairs (UBPs), unnatural backbones, tags, or other evolutionarily novel features of unnatural DNA. In this review, we provide a brief overview of the chemistry and properties of replicative DNA polymerases and their evolved variants, focusing on the Klenow fragment of Taq DNA polymerase (Klentaq). We describe comparative structural, enzymatic, and molecular dynamics studies of WT and Klentaq variants, complexed with natural or noncanonical substrates. Combining these methods provides insight into how specific amino acid substitutions distant from the active site in a Klentaq DNA polymerase variant (ZP Klentaq) contribute to its ability to replicate UBPs with improved efficiency compared with Klentaq. This approach can therefore serve to guide any future rational engineering of replicative DNA polymerases.
Zahra Ouaray, Steven A Benner, Millie M Georgiadis, Nigel G J Richards

2463 related Products with: Building better polymerases: Engineering the replication of expanded genetic alphabets.

100.00 ul 1 G100 U200 units100 1 ml1500IU1100.00 ul

Related Pathways

paperclip

#33453884   2020/11/05 To Up

Dynamic light scattering and fluorescence dual-signal sensing of cancer antigen-125 via recognition of the polymerase chain reaction product with gold nanoparticle probe.

Cancer antigen 125 (CA - 125) is an important biomarker for the diagnosis of ovarian cancer. In this paper, oligonucleotide 5'-GACAGGCCCGAAGGAATAGATAATACGACTCACTATAGGGAGACAAGAATAAACGCTCAA-3' (oligo 1) contains an aptamer of CA - 125, and was designed partly complementary to oligonucleotide 5'-CTCTCTCTCCACCTTCTTCTTTGAGCGTTTATTCTTGTCT-3' (oligo 2). Oligo 1 · oligo 2 was extended with the Klenow fragment (exo) polymerase for further polymerase chain reaction (PCR) processes in the presence of two primers: deoxyribose nucleoside triphosphate and Taq polymerase. Single-stranded DNA was produced at two sides of the PCR product by introducing a C spacer into the two primers, which could hybridize with AuNPs-DNA probes, investigated by dynamic light scattering and fluorescence. The addition of CA - 125 can interrupt the hybridization between oligo 1 and oligo 2, causing the average diameter of AuNPs-DNA probes to decrease with the increase of CA-125 within the range of 5 fg mL - 50 ng mL. The linear regression equation of this relationship was D = 430.48-49.60 logC, with a detection limit of 1.1 fg mL. Fluorescein molecules were modified at the end of the forward primer. The fluorescence intensity of the PCR product can be measured simultaneously, with the fluorescence intensity increasing linearly with the logarithm of CA-125 concentration within a linear range from 10 fg mL to 50 ng mL, with a detection limit of 1.5 fg mL.
Ruidi Shen, Ji Zhang, Wenxiu Huang, Shaoyong Wu, Gongke Li, Seyin Zou, Liansheng Ling

1581 related Products with: Dynamic light scattering and fluorescence dual-signal sensing of cancer antigen-125 via recognition of the polymerase chain reaction product with gold nanoparticle probe.

1 kit100 ug/vial100 ug/vial0.1ml100 ug/vial1 kit(96 Wells)200 100 ug/vial1 mg1 mg100ug/vial

Related Pathways

paperclip

#33426769   2021/01/11 To Up

Using the Integrated Genome Viewer to reveal amplicon-derived polymorphism enriched at the phenylthiocarbamide locus in the teaching lab.

Due to its distinct phenotype and relatively simple inheritance pattern, the phenylthiocarbamide (PTC) loci is frequently utilized in teaching laboratories to demonstrate genetic concepts such as Mendelian inheritance and population genetics. We have developed a next-generation sequencing and bioinformatics approach to analyze the PTC gene locus to reveal single nucleotide polymorphism (SNP) variation at nucleotide position 785 that predicts tasting ability in humans. Here students purify DNA from their own cheek cells, perform polymerase chain reaction (PCR) amplification of the PTC gene followed by cleaved amplified polymorphic sequence (CAPS) testing. Students perform a second PCR on the PTC loci using high-fidelity Taq to create bar-coded amplicons for next-generation sequencing on the Ion Torrent Personal Genome Machine. Bioinformatic verification reveals polymorphic variation by aligning the entire class PTC PCR fragment sequence to the human gene using Bowtie2 and visualizing the results in the Integrated Genome Viewer. This exercise presents a learning opportunity for students to use next-generation sequencing to predict their own PTC taste sensitivity phenotype coupled with the standard CAPS method. This approach brings the PTC teaching method into the genomics era.
Eric D Brenner, Paul E Scheid, Justin DeGrazia, Alexa R Geltzeiler, Manpreet S Katari

1982 related Products with: Using the Integrated Genome Viewer to reveal amplicon-derived polymorphism enriched at the phenylthiocarbamide locus in the teaching lab.

1100 U100 200 units

Related Pathways

paperclip

#33420335   2021/01/08 To Up

False negatives in GBA1 sequencing due to polymerase dependent allelic imbalance.

A variant in the GBA1 gene is one of the most common genetic risk factors to develop Parkinson's disease (PD). Here the serendipitous finding is reported of a polymerase dependent allelic imbalance when using next generation sequencing, potentially resulting in false-negative results when the allele frequency falls below the variant calling threshold (by default commonly at 30%). The full GBA1 gene was sequenced using next generation sequencing on saliva derived DNA from PD patients. Four polymerase chain reaction conditions were varied in twelve samples, to investigate the effect on allelic imbalance: (1) the primers (n = 4); (2) the polymerase enzymes (n = 2); (3) the primer annealing temperature (T) specified for the used polymerase; and (4) the amount of DNA input. Initially, 1295 samples were sequenced using Q5 High-Fidelity DNA Polymerase. 112 samples (8.6%) had an exonic variant and an additional 104 samples (8.0%) had an exonic variant that did not pass the variant frequency calling threshold of 30%. After changing the polymerase to TaKaRa LA Taq DNA Polymerase Hot-Start Version: RR042B, all samples had an allele frequency passing the calling threshold. Allele frequency was unaffected by a change in primer, annealing temperature or amount of DNA input. Sequencing of the GBA1 gene using next generation sequencing might be susceptible to a polymerase specific allelic imbalance, which can result in a large amount of flase-negative results. This was resolved in our case by changing the polymerase. Regions displaying low variant calling frequencies in GBA1 sequencing output in previous and future studies might warrant additional scrutiny.
Jonas M den Heijer, Arnoud Schmitz, Peter Lansbury, Valerie C Cullen, Dana C Hilt, Vincenzo Bonifati, Geert Jan Groeneveld

1882 related Products with: False negatives in GBA1 sequencing due to polymerase dependent allelic imbalance.

2000 Units1 kit10100 1000 Units1 kit96 wells500 gm.1000 Units

Related Pathways

paperclip

#33415847   2021/01/07 To Up

Characteristics of DNA polymerase I from an extreme thermophile, Thermus scotoductus strain K1.

Several native and engineered heat-stable DNA polymerases from a variety of sources are used as powerful tools in different molecular techniques, including polymerase chain reaction, medical diagnostics, DNA sequencing, biological diversity assessments, and in vitro mutagenesis. The DNA polymerase from the extreme thermophile, Thermus scotoductus strain K1, (TsK1) was expressed in Escherichia coli, purified, and characterized. This enzyme belongs to a distinct phylogenetic clade, different from the commonly used DNA polymerase I enzymes, including those from Thermus aquaticus and Thermus thermophilus. The enzyme demonstrated an optimal temperature and pH value of 72-74°C and 9.0, respectively, and could efficiently amplify 2.5 kb DNA products. TsK1 DNA polymerase did not require additional K ions but it did need Mg at 3-5 mM for optimal activity. It was stable for at least 1 h at 80°C, and its half-life at 88 and 95°C was 30 and 15 min, respectively. Analysis of the mutation frequency in the amplified products demonstrated that the base insertion fidelity for this enzyme was significantly better than that of Taq DNA polymerase. These results suggest that TsK1 DNA polymerase could be useful in various molecular applications, including high-temperature DNA polymerization.
Ani Saghatelyan, Hovik Panosyan, Armen Trchounian, Nils-Kåre Birkeland

1043 related Products with: Characteristics of DNA polymerase I from an extreme thermophile, Thermus scotoductus strain K1.

100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized

Related Pathways

paperclip

#33378999   2020/10/31 To Up

All-in-one approaches for rapid and highly specific quantifcation of single nucleotide polymorphisms based on ligase detection reaction using molecular beacons as turn-on probes.

Rapid, simple, specific and sensitive approaches for single nucleotide polymorphisms (SNPs) detection are essential for clinical diagnosis. In this study, all-in-one approaches, consisting of the whole detection process including ligase detection reaction (LDR) and real time quantitative polymerase chain reaction performed in one PCR tube by a one-step operation on a real-time PCR system using molecular beacon (MB) as turn-on probe, were developed for rapid, simple, specific and sensitive quantifcation of SNPs. High specificity of the all-in-one approach was achieved by using the LDR, which employs a thermostable and single-base discerning Hifi Taq DNA ligase to ligate adjacently hybridized LDR-specific probes. In addition, a highly specific probe, MB, was used to detect the products of all-in-one approach, which doubly enhances the specificity of the all-in-one approach. The linear dynamic range and high sensitivity of mutant DNA (MutDNA) and wild-type DNA (WtDNA) all-in-one approaches for the detection of MutDNA and WtDNA were studied in vitro, with a broad linear dynamic range of 0.1 fM to 1 pM and detection limits of 65.3 aM and 31.2 aM, respectively. In addition, the MutDNA and WtDNA all-in-one approaches were able to accurately detect allele frequency changes as low as 0.1%. In particular, the epidermal growth factor receptor T790M MutDNA frequency in the tissue of five patients with non-small cell lung cancer detected by all-in-one approaches were in agreement with clinical detection results, indicating the excellent practicability of the developed approaches for the quantification of SNPs in real samples. In summary, the developed all-in-one approaches exhibited promising potential for further applications in clinical diagnosis.
Wancun Zhang, Kangbo Liu, Pin Zhang, Weyland Cheng, Yaodong Zhang, Linfei Li, Zhidan Yu, Mengmeng Chen, Lin Chen, Lifeng Li, Xianwei Zhang

1929 related Products with: All-in-one approaches for rapid and highly specific quantifcation of single nucleotide polymorphisms based on ligase detection reaction using molecular beacons as turn-on probes.

1 mg2.5 mg2 Pieces/BoxFor 2 miRNA probes, each 4 Membranes/Box 96 Tests 2 Pieces/Box 2 ml Ready-to-use 4 Membranes/Box96 reactions4 Arrays/Slide

Related Pathways

paperclip

#33366444   2019/12/12 To Up

Fidelity of DNA polymerases in the detection of intraindividual variation of mitochondrial DNA.

Here we investigated the consequences of PCR amplification errors in the identification of intraindividual mtDNA variation. The bumblebee was chosen as model for the gene amplification tests with two DNA polymerases ( and Q5) presenting different error rates. The amplifications using resulted in a significant increase of singleton haplotypes per individual in comparison to Q5. The sequence characteristics indicated that resulted haplotypes are mostly due to amplification errors. Studies focusing on intraindividual variability should address special attention to the DNA polymerase fidelity to avoid overestimation of heteroplasmic haplotypes.
Paulo Cseri Ricardo, Elaine Françoso, Maria Cristina Arias

2998 related Products with: Fidelity of DNA polymerases in the detection of intraindividual variation of mitochondrial DNA.

5 G1

Related Pathways