Only in Titles

Search results for: EasyScript Plus RT

paperclip

#33660222   2021/03/03 To Up

SEOM clinical guidelines for pancreatic and biliary tract cancer (2020).

Pancreatic cancer (PC) and biliary tract cancer (BTC) are both aggressive and highly fatal malignancies. Nowadays we have a profound knowledge about the molecular landscape of these neoplasms and this has allowed new therapeutic options. Surgery is the only potentially curative therapy in both cancers, but disease recurrence is frequent. In PC, adjuvant treatment with mFOLFIRINOX has improved overall survival (OS) and in BTC adjuvant treatment with capecitabine seems to improve OS and relapse-free survival. Concomitant radio-chemotherapy could also be considered following R1 surgery in both neoplasms. Neoadjuvant treatment represents the best option for achieving an R0 resection in borderline PC. Upfront systemic chemotherapy is the treatment of choice in unresectable locally advanced PC and BTC; then locoregional therapy could be considered after an initial period of at least 3-4 months of systemic chemotherapy. In metastatic PC, FOLFIRINOX or Gemcitabine plus nab-paclitaxel have improved OS compared with gemcitabine alone. In metastatic BTC, cisplatin plus gemcitabine constitute the standard treatment. Progress in the knowledge of molecular biology has enabled the identification of new targets for therapy with encouraging results that could in the future improve the survival and quality of life of patients with PC and BTC.
Mª A Gómez-España, A F Montes, R Garcia-Carbonero, T M Mercadé, J Maurel, A M Martín, R Pazo-Cid, R Vera, A Carrato, J Feliu

1270 related Products with: SEOM clinical guidelines for pancreatic and biliary tract cancer (2020).



Related Pathways

paperclip

#33660119   2021/03/03 To Up

Intracranial germ cells tumour: a single institution experience in Argentina.

Intracranial germ cell tumor (iGCT) represents a rare and heterogeneous group, with variable incidence and diverse treatment strategies. Although multiagent chemotherapy with reduced radiotherapy strategy has been applied by several cooperative groups in North America and Western Europe, there is a paucity of data to understand if this combined regimen is suitable in low-middle income countries (LMIC).
Lorena V Baroni, Agustina Oller, Candela S Freytes, Claudia V Sampor, Natalia Pinto, Nicolas Ponce Fernandez, Carlos Rugilo, Fabiana Lubieniecki, Pedro Zubizarreta, Daniel Alderete

1864 related Products with: Intracranial germ cells tumour: a single institution experience in Argentina.

1.00 flask100 µg1.00 flask96 tests1 mg96 assays2 ml100 µg50 100ug Lyophilized

Related Pathways

paperclip

#33660021   2021/03/03 To Up

Expression profiling of miRNA-196a biomarker in naïve hepatitis C virus-infected and Sofosbuvir plus Daclatasvir-treated patients.

Micro-RNA (miRNA) is a short stretch of nucleotides that can regulate many genes associated with the various stages of the hepatitis C virus (HCV) life cycle and disease progression. This study evaluates the expression profiling of miRNA-196a in naïve HCV-infected, and Sofosbuvir plus Daclatasvir-treated patients. MiRNA-196a can inhibit HCV replication by silencing the HCV NS5A protein or downregulating the human BACH-I mRNA. The expression level of miRNA-196a was determined by quantitative reverse transcription PCR (RT-qPCR) using the whole RNA extracted from the recruited participant's serum. Results showed a 0.83-fold decrease in the miRNA-196a level in naïve HCV-infected than controls. On the contrary, an increase in the expression level by 0.06-fold was observed in Sofosbuvir plus Daclatasvir-treated patients. A negative but significant correlation was recorded between the HCV-RNA load and miRNA-196a expression level in the naïve-infected patients. Serum miRNA-196a ROC curve analysis revealed an area under the curve of 0.8278 (95% CI 0.7033-0.9524, p < 0.0001) with 82.05% sensitivity and 76.19% specificity in discriminating the healthy controls from the HCV-infected samples. In conclusion, our study explored the comparative expression levels of miRNA-196a in HCV-infected and Sofosbuvir plus Daclatasvir patients. Further studies are needed to examine the possible role of miR-196a as a therapeutic agent for treating HCV-infected patients.
Nazim Hussain, Nimrah Farooq, Muhammad Maqsood, Muhammad Shahid Riaz Rajoka, Muhammad Bilal

2068 related Products with: Expression profiling of miRNA-196a biomarker in naïve hepatitis C virus-infected and Sofosbuvir plus Daclatasvir-treated patients.

100 100ug Lyophilized100ug Lyophilized100ug100ug Lyophilized 25 ml Ready-to-use 96T100 µg100ug Lyophilized100ug Lyophilized100ug100ug Lyophilized

Related Pathways

paperclip

#33656365   2021/03/03 To Up

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.
Alejandro Olmedo Velarde, Avijit Roy, Chellappan Padmanabhan, Schyler Nunziata, Mark K Nakhla, Michael Melzer

2411 related Products with: First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

10 1 mg100 200 100 1096 tests10050 100 1 mg

Related Pathways

paperclip

#33656040   2021/03/03 To Up

Cisplatin nanoparticles boost abscopal effect of radiation plus anti-PD1 therapy.

The abscopal effect of radiation therapy (RT) is clinically significant but occurs rarely. Although anti-programmed cell death protein 1 antibody (anti-PD1) is likely to enhance the abscopal effect in patients receiving RT, the incidence rate remains less than 30%. One major limitation is the paucity of CD8+ T cells within non-irradiated tumors. Here, cisplatin (CDDP) loaded poly(l-glutamic acid)-graft-methoxy poly(ethylene glycol) complex nanoparticles (CDDP-NPs) are confirmed to increase CD8+ T cells within non-irradiated tumors and boost the abscopal effect of RT plus anti-PD1, and more strongly than CDDP. Compared to RT and RT + CDDP, RT + CDDP-NPs induced greater immunogenic cell death (ICD) with enhanced proportion of Calreticulin+ Lewis lung cancer (LLC) cells (16.47%, 20.53% and 27.03%), along with which more CD8+ T cells were infiltrated into CDDP-NP treated irradiated tumors in the unilateral LLC tumor model. In the bilateral LLC tumor model, RT + CDDP-NPs significantly induced more chemokine (C-X-C motif) ligand 10 (CXCL10) secretion (36.3, 44.19 and 56.37 pg mL-1), which corresponded to greater CD8+ T cell infiltration in the non-irradiated tumors (0.19%, 0.20% and 0.72%). Finally, compared to RT + anti-PD1 and RT + anti-PD1 + CDDP, RT + anti-PD1 + CDDP-NPs significantly inhibited the growth of non-irradiated tumors more forcefully, as indicated by the respective tumor volumes of 1141, 1146 and 585 mm3. This is the first study to show that CDDP-NPs can amplify RT-induced immune activation and break through the efficiency limitation of the RT plus anti-PD1 induced abscopal effect.
Ying Wang, Na Shen, Yue Wang, Mo Li, Wanze Zhang, Liwen Fan, Linlin Liu, Zhaohui Tang, Xuesi Chen

2859 related Products with: Cisplatin nanoparticles boost abscopal effect of radiation plus anti-PD1 therapy.

100ug Lyophilized417 μg100ug100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized1 ml100μl100ug100 μg100ug Lyophilized

Related Pathways

paperclip

#33654599   2021/01/26 To Up

Anti-EGFR Antibody Plus Chemotherapy Treatment in a Patient with Synchronous Merkel Cell Carcinoma and Colorectal Cancer.

Merkel cell carcinoma (MCC) is a rare neuroendocrine cutaneous malignancy. During early stages, surgery is the primary treatment followed by radiotherapy in patients at high risk of recurrence. Definitive radiation therapy is an alternative for patients who are not surgical candidates, reserving chemotherapy for metastatic disease. We present a case of a male patient diagnosed with MCC and stage IV colorectal cancer and we focus on the skin tumor shrinkage after specific colorectal cancer treatment.
Sara Custodio-Cabello, Luis Cabezón-Gutiérrez, Magda Palka-Kotlowska, Eduardo Oliveros Acebes, Parham Khosravi-Shahi

1199 related Products with: Anti-EGFR Antibody Plus Chemotherapy Treatment in a Patient with Synchronous Merkel Cell Carcinoma and Colorectal Cancer.

100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized100ug Lyophilized

Related Pathways

paperclip

#33649873   2021/03/01 To Up

The Role of Radiation Therapy for Symptomatic Desmoid Tumors.

Desmoid tumors have a variable clinical course that ranges from indolence or spontaneous regression to an aggressive pattern marked by local invasion. Up to half may remain stable or regress; watchful waiting is the preferred approach in the initial management of desmoid tumors. Symptomatic or progressive tumors or those that may affect adjacent critical structures require surgery, radiotherapy, or systemic therapy. Although radiotherapy effectively controls desmoid tumors in most cases, concerns regarding late toxicity exist. Definitive radiotherapy for macroscopic disease is indicated when a non-morbid complete surgical resection cannot be accomplished and provides similar control rates to surgery plus radiotherapy but avoids toxicity from combined-modality treatment (surgery and radiotherapy). Adjuvant radiotherapy can be considered for microscopically involved margins, particularly for recurrent cases or when a future recurrence may be challenging to treat. Large size, extremity site, and younger age are poor prognostic factors after radiotherapy. In the extremity, radiotherapy may have superior outcomes to surgery. Younger patients, especially children, are challenging to manage as they are at particular risk for late toxicity due to the number of potential years at risk. For patients under 20 years old, for whom a non-morbid complete resection is not possible, we recommend systemic therapy as the first line of treatment. Although the long-term efficacy of systemic therapy is unproven, this strategy allows additional time for growth and development prior to radiotherapy. In younger patients and those with axial desmoid tumors adjacent to critical organs, consideration should be given to using proton therapy as the dosimetric advantages may mitigate some of the toxicity associated with conventional radiotherapy.
Wen Shen Looi, Daniel J Indelicato, Michael S Rutenberg

1197 related Products with: The Role of Radiation Therapy for Symptomatic Desmoid Tumors.

0.2 mg200 units 1 G 25 G11 ml 50 UG10 lt 1000 ml 11,000 tests

Related Pathways

paperclip

#33644048   2021/02/11 To Up

Mechanisms of Pharmaceutical Therapy and Drug Resistance in Esophageal Cancer.

Pharmaceutical therapies are essential for esophageal cancer (EC). For the advanced EC, the neoadjuvant therapy regimen, including chemotherapy plus radiotherapy and/or immunotherapy, is effective to achieve clinical benefit, even pathological complete response. For the unresectable, recurrent, and metastatic EC, the pharmaceutical therapy is the limited effective regimen to alleviate the disease and prolong the progression-free survival and overall survival. In this review, we focus on the pharmaceutical applications in EC treatment including cytotoxic agents, molecular targeted antibodies, and immune checkpoint inhibitors (ICIs). The chemotherapy regimen is based on cytotoxic agents such as platinum-based complexes, fluorinated pyrimidines and taxenes. Although the cytotoxic agents have been developed in past decades, the standard chemotherapy regimen is still the cisplatin and 5-FU or paclitaxel because the derived drugs have no significant advantages of overcoming the shortcomings of side effects and drug resistance. The targeted molecular therapy is an essential supplement for chemotherapy; however, there are only a few targeted therapies available in clinical practice. Trastuzumab and ramucirumab are the only two molecular therapy drugs which are approved by the US Food and Drug Administration to treat advanced and/or metastatic EC. Although the targeted therapy usually achieves effective benefits in the early stage therapy of EC, the patients will always develop drug resistance during treatment. ICIs have had a significant impact on routine clinical practice in cancer treatment. The anti-programmed cell death-1 monoclonal antibodies pembrolizumab and nivolumab, as the ICIs, are recommended for advanced EC by several clinical trials. However, the significant issues of pharmaceutical treatment are still the dose-limiting side effects and primary or secondary drug resistance. These defects of pharmaceutical therapy restrain the clinical application and diminish the effectiveness of treatment.
Chengyi Mao, Xiaoxi Zeng, Chao Zhang, Yushang Yang, Xin Xiao, Siyuan Luan, Yonggang Zhang, Yong Yuan

1343 related Products with: Mechanisms of Pharmaceutical Therapy and Drug Resistance in Esophageal Cancer.



Related Pathways

paperclip

#33643906   2021/02/10 To Up

Prognosis and Prophylactic Regional Nodal Irradiation in Breast Cancer Patients With the First Isolated Chest Wall Recurrence After Mastectomy.

Optimal radiation target volumes for breast cancer patients with their first isolated chest wall recurrence (ICWR) after mastectomy are controversial. We aimed to analyze the regional failure patterns and to investigate the role of prophylactic regional nodal irradiation (RNI) for ICWR.
Xu-Ran Zhao, Liang Xuan, Jun Yin, Yu Tang, Hui-Ru Sun, Hao Jing, Yong-Wen Song, Jing Jin, Yue-Ping Liu, Hui Fang, Hua Ren, Bo Chen, Yuan Tang, Ning Li, Shu-Nan Qi, Ning-Ning Lu, Yong Yang, Ye-Xiong Li, Bing Sun, Shi-Kai Wu, Shu-Lian Wang

2011 related Products with: Prognosis and Prophylactic Regional Nodal Irradiation in Breast Cancer Patients With the First Isolated Chest Wall Recurrence After Mastectomy.



Related Pathways

paperclip

Error loading info... Pleas try again later.